I have heard that humans share 99.9% of their DNA with other humans. I have also heard that a child shares 50% of their DNA with their parents. How do I resolve this apparent contradiction? It has been really bothering me.
-
1There was another recent question about this that gave an answer that is equivalent to the answer for your question, asking about Neanderthal DNA in Homo sapiens sapiens, see here: https://biology.stackexchange.com/questions/61147/neanderthal-human-genetics The short version is: they are talking about slightly different things. – Bryan Krause Jun 29 '17 at 00:21
-
1See here: https://biology.stackexchange.com/questions/41974/why-are-the-genomes-of-humans-99-5-the-same as well – Bryan Krause Jun 29 '17 at 00:24
-
1And here we go with that 99.9% again: https://biology.stackexchange.com/a/61078/24284 – Jun 29 '17 at 06:15
-
2Why was the question down voted? I think it is a common misunderstanding. We have already seen such misunderstanding several time on Biology.SE but it is the first time that the origin of the misunderstanding was so clearly phrased. I think it is a good question. – Remi.b Jun 29 '17 at 22:06
1 Answers
It will be clear with a simple analogy.
You are 50% related to any one of your parent
Let's say you don't have any biology books. You have two friends, Alice and Bob. They each give you a copy of the book Campbell Biology. You now have two Campbell Biology. You have received 50% of your Campbell biology books from Alice and 50% from Bob.
Similarly, you inherit 50% of your DNA from your mother and 50% from your father. You are related at 50% to any one of them.
Two randomly sampled individual are 99.9% identical
Now consider the list of all the copies of Campbell Biology in the world. As there exist different editions, all Campbell Biology won't exactly be the same. Let's say you randomly sample two Campbell Biology from around the world and you align them letter by letter. What is the expected fraction of the letters that will be identical? If, for example you find the two sentences
Selection is a fitness variance associated to a genetic variance among individuals in a population.
and
Zelection is a fitnezz varianze azzociated to a genetic varianze among individualz in a populazion.
There are exactly 9 mismatches out of 99 characters, that is a 90% similitude.
Similarly, if you randomly sample two humans, align their DNA (a DNA sequence look like ATTTCGCTGTCGAATCGATCGGTA), you'll find that the fraction of mismatch is lower than 0.1%. Therefore, we all share 99.9% of our DNA.
Of course, alining DNA sequences (or normal sentences) is not quite that easy as some sequences (or sentence) can have more nucleotides (or letters) than others but I won't go into the details here.
How do these two measures relate?
Let's say that instead of giving you a book, Alice actually produced a copy of its book and gave it to you. The book you have received from Alice (that is 50% of all your Campbell Biology books) is 100% identical to Alice's book in term of mismatch.
Similarly, the 50% of your DNA that you inherit from your father (or mother) is 100% identical to the copy of the genome found in your mother.
Note however that
Your mother probably made between 10 and 100 mutations when copying her DNA so that the DNA you received from your mother is not exactly 100% identical to your mother's DNA
- Similarly Alice could have miscopied her Campbell Biology book that she passes to you
Your mother actually recombined her two haplotypes
- Similarly Alice actually had two different editions of Campbell Biology and she mixed them up a little bit before copying the resulting book!
- 68,088
- 11
- 141
- 234
-
1Good answer. +1 But could you add a link between the two? E.g. that the 50% you have from your parents are 100% identical to the respective parent in terms of 'shared mismatches' (disregarding the 60-100 de novo mutations) and that because of this the expected identity between parents and offspring is way higher than between randomly sampled individuals. – AlexDeLarge Jun 29 '17 at 10:05
-
@AlexDeLarge Very good point, thank you. I tried to add that. Feel free to rephrase it if you think you can make it easier to understand. – Remi.b Jun 29 '17 at 10:21